A TI{KozakGAL4} DNA cassette has been inserted into Ho, replacing the coding sequence (coordinates of deleted sequence are 3R:11679788..11680877 , release 6 genome). This results in a simultaneous knock-out of Ho plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ho (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AGTTCAAAACAAAACAAAGACGG and TGCTCTCAAGTAAGAAAAGTAGG. The 5' end of the deletion associated with the insertion is 98 bp from the 5' end of the Taf12 gene and may affect its expression. The 3' end of the deletion associated with the insertion is 95 bp downstream of the 3' end of the CG6830 gene and may affect the proper 3' end formation of its transcripts.