A TI{KozakGAL4} DNA cassette has been inserted into xit, replacing the coding sequence (coordinates of deleted sequence are X:6821081..6822849 , release 6 genome). The 3' end of the deletion extends 9 bp downstream of the annotated 3' end of the xit gene. This results in a simultaneous knock-out of xit plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of xit (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTTCATCTTCGTTTCTCTCAGGG and CTTCAGCAGAAATCCGCAATTGG.