A TI{CRIMIC.TG4.1} DNA cassette has been inserted into Zip99C, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Zip99C downstream of the inserted gene trap cassette have been deleted. The 3' end of the deletion associated with the insertion extends to within 69 bp from the annotated 3' end of the RpS8-RC transcript and may affect its proper 3' end formation. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Zip99C : one targeted to a coding intron (TGACTAGAAGGATCTTTAGGAGG) and the other to a non-coding exon in the 3' UTR (TTCCTAGTGTTCGAATAGCATGG).