19bp insertion between 4:228201 and 4:228202 (R6) and base pair change C228202T resulting in addition of IIFHIYFNFCATPTIYFKWRLCTKK after tyrosine 66 of all yellow-h protein isoforms and premature truncation after these novel amino acids.
TATTATATTTCATATATATT
The sequence TATTATATTTCATATATATT replaces C228202 in yellow-h resulting in a frameshift and early translation termination after the additon of 25 novel amino acids (IIFHIYFNFCATPTIYFKWRLCTKK).