A TI{KozakGAL4} DNA cassette has been inserted into thoc6, replacing the coding sequence (coordinates of deleted sequence are 3L:12192595..12193682 , release 6 genome). This results in a simultaneous knock-out of thoc6 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of thoc6 (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 67 bp downstream of the 3' end of the Est-P gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTGTTCTTGGTATATTGCTCAGG and ACATCTCAATCTTGCTGTCGAGG.