UAS sequences (from the pVALIUM20 vector) regulate expression of a short hairpin RNA (shRNA) that targets bon (the hairpin contains an inverted repeat of CACACTCGTTTCCGAAATCAA).
fertile, with Scer\GAL4VP16.bam
fertile, with Scer\GAL4VP16.bam, Scer\GAL4VP16.mat.αTub67C
fertile, with Scer\GAL4VP16.mat.αTub67C
increased cell death | oogenesis, with Scer\GAL4VP16.nanos.UTR
sterile, with Scer\GAL4VP16.bam, Scer\GAL4VP16.nanos.UTR
female germline cell | decreased number, with Scer\GAL4VP16.bam, Scer\GAL4VP16.nanos.UTR
female germline stem cell, with Scer\GAL4VP16.nanos.UTR
fusome | oogenesis, with Scer\GAL4VP16.nanos.UTR
ovary, with Scer\GAL4VP16.bam, Scer\GAL4VP16.nanos.UTR
ovary, with Scer\GAL4VP16.nanos.UTR