A TI{CRIMIC.TG4.0} DNA cassette has been inserted into CG10466, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG10466 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG10466 : one targeted to a coding intron (CAAGTTTAAACAATGATTTCAGG) and the other to a non-coding exon in the 3' UTR (AAATTATAGATGATAAGATAAGG). The 3' end of the deletion associated with the insertion extends to within 19 bp from the annotated 3' end of the fs(2)ltoPP43 and may affect its proper 3' end formation.