A TI{KozakGAL4} DNA cassette has been inserted into GluRS-m, replacing most of the coding sequence (coordinates of deleted sequence are 3L:16415451..16417143 , release 6 genome); the 3' end of the deletion is 59 bp upstream of the stop codon. This results in a simultaneous knock-out of GluRS-m plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of GluRS-m (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 65 bp downstream of the 3' end of the Serinc gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGTAAACAAAAAACCGGCATAGG and TTTGAGTCGTTCGAGAGTGACGG.