UAS sequences (from pWALIUM22) regulate expression of of a short hairpin RNA (shRNA) that targets AnxB11 (the hairpin contains an inverted repeat of GGAGACGTCGGGCAACTTTAA).
abnormal wound healing | embryonic stage, with Scer\GAL4VP16.mat.αTub67C
actomyosin contractile ring actin filament | embryonic stage, with Scer\GAL4VP16.mat.αTub67C
AnxB10HMS02294, AnxB11RNAi.UAS.1, AnxB9HMJ22047, Scer\GAL4VP16.mat.αTub67C has abnormal wound healing | embryonic stage phenotype
AnxB10HMS02294, AnxB11RNAi.UAS.1, AnxB9HMJ22047, Scer\GAL4VP16.mat.αTub67C has actomyosin contractile ring actin filament | embryonic stage phenotype