UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of three shRNAs that each target a different gene; the targets are CycC (hairpin contains an inverted repeat of CACGGCGACGGTTTACTTCAA), Cdk8 (hairpin contains an inverted repeat of CAAGGTGTTCCTGTTGATCGA) and kto (hairpin contains an inverted repeat of CAGATGCTACGACAACGACAA).
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4ey.PU, ktoTH00599.S has visible | adult stage phenotype
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4ey.PU, ktoTH00599.S has decreased size | adult stage phenotype
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4ap-md544, ktoTH00599.S has visible | adult stage phenotype
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4ey.PU, ktoTH00599.S has eye phenotype
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4ap-md544, ktoTH00599.S has wing phenotype
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4ap-md544, ktoTH00599.S has wing disc dorsal compartment | larval stage phenotype
Cdk8TH00599.S, CycCTH00599.S, Scer\GAL4nub-AC-62, ktoTH00599.S has wing disc | larval stage phenotype