UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets CycC (this hairpin contains an inverted repeat of CAAGGTGTTCCTGTTGATCGA) and the second targets skd (this hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA).
CycCTH00502.N, Scer\GAL4ey.PU, skdTH00502.N has visible | adult stage phenotype
CycCTH00502.N, Scer\GAL4ey.PU, skdTH00502.N has decreased size | adult stage phenotype
CycCTH00502.N, Scer\GAL4ey.PU, skdTH00502.N has eye phenotype