UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets Cdk8 (this hairpin contains an inverted repeat of CAAGGTGTTCCTGTTGATCGA) and the second targets skd (this hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA).
Cdk8TH00596.S, Scer\GAL4ey.PU, skdTH00596.S has visible | adult stage phenotype
Cdk8TH00596.S, Scer\GAL4ey.PU, skdTH00596.S has decreased size | adult stage phenotype
Cdk8TH00596.S, Scer\GAL4ey.PU, skdTH00596.S has eye phenotype