UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets skd (this hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA) and the second targets CycC (this hairpin contains an inverted repeat of CACGGCGACGGTTTACTTCAA).
CycCTH00598.S, Scer\GAL4ey.PU, skdTH00598.S has visible | adult stage phenotype
CycCTH00598.S, Scer\GAL4ey.PU, skdTH00598.S has decreased size | adult stage phenotype
CycCTH00598.S, Scer\GAL4ey.PU, skdTH00598.S has eye phenotype