AGTCCACCCTGCACTTGGTGCTCCGCCTGCGTGGTGGTATCATTGAGCCCTCGCTCAGGATTCTGGCCCAGAAGTACAAC TGCGACAAGATGATCTNCCGCAAGTGCTACGCCCGTCTGCATCCTCGTGCCACCAACTGCCGCAAGAAGAAGTGCGGACA CACCAACAACCTGCGCCCCAAGAAGAAGTTGAAGTAGACTATGATCATCCGTCGACGGTCCAGGCTGGTCTTTCTATCGA CAAAACCATG
Partial cDNAs generated with the GLGI technique; extend from the 3' poly(A) tail to the first CATG.
A combination of embryos, second and third larvae, third day pupae, and young and aged adults, irradiated embryos and testis were used.
Four SAGE libraries were constructed: (1) pooled sample including equal amounts of total RNA from embryos, second and third larvae, third day pupae, and young and aged adults, (2) embryos, (3) irradiated embryos and (4) testis. Unmatched (to annotated transcripts) SAGE tags from the four libraries were converted into 3' cDNAs using the GLGI (generation of longer 3' cDNA from SAGE tag for gene identification) method. Sequences extend from the poly(A) tail to the first CATG site.
GenBank CB305186-CB305318.