ATTAAACTAAAAACGACTCGACAGCCCTGGTGCTATCGATGCTATAATCGGATCGATTTACGCAGATTGGTCGCACACCC GCCAGTGGAAACGCCAGCAGCTCCAGTTGGCACACCGAGCCCAGCTGAAGGATCAGCGCTAAGAGGATACACAAATATAC ACCATGGTCTTGGGACTGGATAAGCGAGCACTGTGGGGCGCGTTGCCCCTGCTGGGATTTGCCATTGGCCACTTCCTGGA CAAGAAGGAAACGGAACGTATGACCATGTTCCGGGACAAGAGTGCCCTATACGGCCGTCCCGCCGGCAGCGAGGGTAAGG CGCCATCCTGGTAGGCCTGCCCAACATCGCCATCCCAAAATATTATCTTTTTTCCCCCAATTCACTGTTATTCAATAAAC CGGAGAAATGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Cloned cDNAs prepared from polyadenylated RNA isolated from adults of both sexes.
The TA (Total Adult) cDNA library was made by Mark Stapleton and Charles Yu from mixed male and female adults of the isogenic y; cn bw sp (iso-1) strain.
Total RNA was processed with CIP and TAP in order to ligate an RNA adapter (RLM oligo: GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA) to decapped mRNA using T4 RNA ligase. This processing step is similar to the preparation of RNAfor 5' RACE. Components of the FirstChoice RLM-RACE Kit (Ambion) were used in this processing step. mRNA was then isolated using the PolyAPurist Mag isolation system (Ambion). First strand synthesis was carried out using PowerScript Reverse Transcriptase and an oligo dT primer adapter (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30VN-3') from the Creator cDNA Library Construction kit (Clontech). Second Strand synthesis was carried out with Advantage 2 enzyme using 5 cycles of PCR with the first strand primer and a primer that anneals within the RLM oligo (AGTCGGCCTTGTCGGCCCTGCGTTTGCTGGCTTTGATG). Double-stranded cDNA was digested with SfiI and ds-cDNA > 200bp was purified using the Gene Clean Gel Extraction Kit (BioRad). Purified cDNA was then directionally ligated into the DraIII digested pOTB7D vector. cDNAs were transformed into DH5-alpha.