Gene or accession: CG2699 DNA error at position 7676. Upstream nucleotides: gtggagcggggagggttgca Substitution: base C should be T. Comments: Celera sequence: AE003590; AAF51510.1 encodes a 496 aa protein. Published cDNAs, Weinkove et al, J. Biol. Chem. 272:14606-14610 (1997): Y12498; CAA73100.1 and Y11143; CAA72030.1 have a 506 amino acid protein that extends 10 amino acids upstream from the Celera N-terminus. Could you please check the sequence as stated above to see if the Celera sequence really does have an upstream initiating Met that agrees with the cDNAs. thanks