Gene or accession: CG8766
DNA error at position 61375. Upstream nucleotides: tggatgtgcccaccggcgtg
Insertion of length 1: g.
Corrected sequence: GCGTGCGATG.
Comments: FBrf0113255 == Benevolenskaya, 1997.8.7, GenBank/EMBL/DDBJ: AF017783
Sequence from this Ref is a cDNA that corresponds to the shorter isoform
annotated by Celera AE003821; AAF58462.1
Sequence comparison reveals the cDNA has a, with respect to Celera,
deletion of one base. This deletion causes a frameshift that identifies a
different possible initiating Met for the shorter splice isoform.
Could you please check the sequence to confirm which is correct.
thanks