Gene or accession: CG2094
DNA error at position 59361. Upstream nucleotides: aagttcgtcgcttccgcgct
Substitution: base g should be a.
Comments: Sequence for PTB (AF211191; AAF22979) is a cDNA that starts
translation
at a Met located 13 amino acids upstream of the init Met in Celera
CG2094 (AE003780; AAF57208).
There may be a sequencing error that is hiding this upstream possible
initiating Met.
thanks