Gene or accession: CG6419
Gene annotation error
Gene CG6419 corresponds to sox-like
Comments: Hi,
I believe that CG6419 (FBgn0036413) corresponds to the gene 'sox-like'
(from FBrf0127030 == Burmester et al., 2000, Gene 246(1-2): 157--167)
for the following reasons:
1. In Figure 2 of FBrf0127030, 'sox-like' is shown as being 25-30kb
upstream of Fbp-1 and distal to it:
\+5 0 \-5 \-10 \-15 \-20 \-25 (kb)
| | | | | | |
\-------------------------------------
<-------- <---
Fbp-1 sox-like
N.B. 'sox-like' has homology to the 'SOX subgroup of the HMG proteins'
(pg.166 of FBrf0127030).
Fbp-1 corresponds to CG17285. Inspection of GeneSeen of the region
surrounding CG17285 shows that there is a CG approximately 25kb
upstream of Fbp-1, transcribed in the correct direction which has
homology to SOX proteins \- this CG is CG6419.
2. In addition, the STS sequence 'Dm1776' is shown within 'sox-like' in
Figure 2. of FBrf0127030.
BLAST against the Drosophila genome using the Dm1776 sequence produces
one hit in the genome that includes all the sequence of Dm1776. This
hit is within the sequence of the CG6419 gene.
..
BLAST results for STS Dm1776 sequence:
RID: 973702669-3828-8512
Query= DM4901.Dm1776
(325 letters)
Database: Drosophila Genome
1181 sequences; 122,680,987 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AE003535.1|AE003535 Drosophila melanogaster genomic scaf... 591 e-168
Alignments
>gb|AE003535.1|AE003535 Drosophila melanogaster genomic scaffold
142000013386050 section 22 of
54, complete sequence
Length = 278748
Score = 591 bits (298), Expect = e-168
Identities = 319/325 (98%), Gaps = 1/325 (0%)
Strand = Plus / Minus
Query: 1 acttacccagccttttggatatctctgaattgtgcatcttaggattatcctgagctatct 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243883 acttacccagccttttggatatctctgaattgtgcatcttaggattatcctgagctatct
243824
Query: 61 tgcgccgctgaagtctcgaccagaccatgaaagcgtgcattggacgttttatgtgctcct 120
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 243823 tgcgccgctgaagtctcgaccagaccatgaaagcgttcattggacgttttatgtgctcct
243764
Query: 121 cgnttgggcgctttgttgtgttctggatcatcagactaaagaagacatcgctgagaaata 180
|| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243763 cgttttggcgctttgttgtgttctggatcatcagactaaagaagacatcgctgagaaata
243704
Query: 181 ataggatagaaacgtgtgaatttaatataattctttacaagatgacatacaaaacttgtt 240
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 243703 ataggatagaaacgtgtgaatttaat-taaatctttacaagatgacatacaaaacttgta
243645
Query: 241 tgcatgtaaaataatcttataaatcacgccacataattttaaaaacagttagttcatttg 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243644 tgcatgtaaaataatcttataaatcacgccacataattttaaaaacagttagttcatttg
243585
Query: 301 aaattactcacctcgcgctgcttcc 325
|||||||||||||||||||||||||
Sbjct: 243584 aaattactcacctcgcgctgcttcc 243560
Score = 52.0 bits (26), Expect = 8e-06
Identities = 71/86 (82%)
Strand = Plus / Minus
Query: 18 gatatctctgaattgtgcatcttaggattatcctgagctatcttgcgccgctgaagtctc 77
||||| || ||||||||||| || ||||| ||||| || || ||||| ||||| | |
Sbjct: 262343 gatatttcagaattgtgcatttttggattgtcctgggccattttgcgacgctgcccccgc
262284
Query: 78 gaccagaccatgaaagcgtgcattgg 103
||||||||||||||||||| ||||||
Sbjct: 262283 gaccagaccatgaaagcgttcattgg 262258
Score = 50.1 bits (25), Expect = 3e-05
Identities = 82/101 (81%)
Strand = Plus / Minus
Query: 15 ttggatatctctgaattgtgcatcttaggattatcctgagctatcttgcgccgctgaagt 74
||||| ||||| || ||||||||||| || ||||||| || |||| || ||||| ||
Sbjct: 192146 ttggagatctcagagttgtgcatcttggggttatccttggcgatctgacgacgctgcagg
192087
Query: 75 ctcgaccagaccatgaaagcgtgcattggacgttttatgtg 115
| |||||||||||||| |||| ||||||||| || |||||
Sbjct: 192086 cgggaccagaccatgaacgcgttcattggacgcttgatgtg 192046