Subject: about hono
Dear Jay
I confirmed the existence of P-element of hono in the region of upstream of
the TyrR gene. The PCR experiment I performed was as follow,
1. extraction of nuclear DNA from single fly of hono, excision line b2-6,
wild type (Oregon-R).
2. PCR using pry4 (sense) and tyrR (antisense) primers. pry4:
caatcatatcgctgtctcactca, tyrR: aacaccttgcacctcgtctat. The PCR condition was
94 degree 2', (94 degree 1', 55 degree 1', 72 degree 2'), 30 cycles, 72
degree 5'. The product (about 1.2 kb) was amplified from hono only. As
positive control, PCR using tyrR primers (sense: tgatgcggtattagaagctgg,
antisense: aacaccttgcacctcgtctat, same primer as above) also conducted and
the product (about 900 bp) was obtained from all strain.
3. Sequencing the product. I found the P-lwB vector sequence and tyrR
sequence in it. The sequence is as follows,
TGCTGTCTCACTCAGACTCAATACGACACTCAGAATACTATTCCTTTCACTCGCACTTATTGCAAGCATACGTTAAGTG
GATGTCTCTTGCCGACGGGACCACCTTATGTTATTTCATCATGGGCCCGGCCGAAAAGGGGAGCCGACCAAGAGGCGAA
CTGTTGCGGGTGGCTAAAGTTTAAGGATGGACCGNTCGCCTTCAGTTCCGTGCGAATTGGCGTTGGGTGTGGACGCGAG
TGGCGGAAGCAGGCGGCGTTGATATATACGAGCTCTTCCATCTTTCGTGATGCGGTATTAGAAGCTGGCAGCTCANAGA
TTCCCGCAAAGTTTAAGTGACAATTTGCCAGCCAACAACAACTTTCCGACGCAGGCAACGCAAATTGAATTCGATTCGA
TTCGATTGTCTCTCGATCTTCATCAATTCATTACGCACAGGAAAAGAGGGCGAACCGTAAAGTTNTGGTGAAAAAGTTT
CCTGGGCTCCGTTGGCGTGGCAAAGCGACCGAAACCAAAACGAAATTTTGAAAATGAGCTTTGCTAACGACNGGCCAAA
CCAATTAACAGAATTCGTTCTTGTGTAATAAATNAATTGCCAACAATTATAACTTGCAGTCCACTNAGGCATATTCAAA
TGAAATGTGCCACAAAAAATGTTTACGGGTCATTGCAACTCAAAAGCGACAGACCATAGACGAGGTGCAAGGTGTTGTG
GCAGTTGCAGAAAAACTAAAAGAAAGCCGTAAGGCTTGACCAAAAATTAATAACTGATAAAAGCAGGTAAGGCAAAACA
CCAGCTTTAACGCGGATTTAGGATATTTAAAACATTTTATAAGAAGTGACAAGTAACTGCTATTTATTTAAAAATATAA
TGCTTATTGCTTATTGGATGGGCGTCAAGTAGTAATAATATAGACCCACAAACTGAACAAAATTTTATTTTATGTATGT
TTCTTCTTTGAACCTTTATCAAGTTCGGAAGCACATTACAA!
T
TAAAAATCAATCAATATTCTTCAAAGCATCCACTTTTATTAAAGACAGAACCTAAGAAATCAGATTTTTAAATCTCCCA
CAAATTTTCCTTGCTCGCATTCTTCCGTAATCCCAAAAAACAAACTTCGCCCATTACCTATGCCAAGGAAAAAGGGCAA
TCCACACTGGGAATGCCAAAAAAGAGCATGTGTGTATTAGGGAA
I suppose that you have failed to confirm the existence of P element
because of unsuitable primers. P-element can not be detected using your
tyrR primers because P-element was inserted more upstream. I remember that
I pointed out about it by phone and e-mail when you came to Japan last year.
Therefore, I request strongly that you withdraw the appeal to the flybase.
If you have any questions about any of this, please do not hesitate to
contact me.
Sincerely,
\--
Mayako Kutsukake, Ph.D.
Microbial and Genetic Resources Research Group
Research Institute of Biological Resources
Tsukuba Central 6
National Institute of Advanced Industrial Science and Technology
1-1-1, Higashi, Ibaraki 305-8566, Japan
Subject: Re: about hono
Dear Mayako and Jay,
I just looked at this using BLAST at the NCBI, out of curiosity (though
I am a relative BLAST-novice). It seems to me that Mayako's sequence
hits the Drosophila genome between 160103 and 161258 of genomic
scaffold 142000013386036.
I figured out where this hits the genome in terms of the annotations.
The insertion site seems to be between CG7140 and TyrR, approximately
7kb upstream of the 5' end of CG7140, and 25kb upstream of the 5' end
of TyrR. Since CG7140 and TyrR are divergently transcribed, the
insertion is upstream of both of these transcription units, and it is
not obvious to me that it is clear that the insertion site identifies
TyrR, and not CG7140, as the gene affected in the hono mutation. It
may be that Mayako has information that places the 5' end of TyrR much
closer to CG7140, but if so that information isn't obvious from what we
have in the public view of the annotations.
In any case the insertion site described below seems very different
from the one stated in
\*x FBrf0126774 == Kutsukake et al., 2000, Gene 245(1): 31--42
where the P insertion was only 1kb or so from the 5' end of TyrR,
so I will be leaving the FlyBase versions of the records as they are
for now.
Best regards,
Rachel.
FlyBase-Cambridge.
Subject: Re: about hono
Dear Rachel
Thank you for your reply and analysis of my sequence. I think I was short
of explanation about my sequence. Let me describe about it more closely.
>
>I just looked at this using BLAST at the NCBI, out of curiosity (though
>I am a relative BLAST-novice). It seems to me that Mayako's sequence
>hits the Drosophila genome between 160103 and 161258 of genomic
>scaffold 142000013386036.
Yes. But 160193 is correct, not 160103.
>I figured out where this hits the genome in terms of the annotations.
>The insertion site seems to be between CG7140 and TyrR, approximately
>7kb upstream of the 5' end of CG7140, and 25kb upstream of the 5' end
>of TyrR. Since CG7140 and TyrR are divergently transcribed, the
>insertion is upstream of both of these transcription units, and it is
>not obvious to me that it is clear that the insertion site identifies
>TyrR, and not CG7140, as the gene affected in the hono mutation. It
>may be that Mayako has information that places the 5' end of TyrR much
>closer to CG7140, but if so that information isn't obvious from what we
>have in the public view of the annotations.
Yes, I have. Information about 5'-UTR sequence of TyrR is available on the
Genbank (Accession No. M60789; D. melanogaster octopamine receptor mRNA,
complete cds., octopamine receptor is old name of tyramine receptor. See
TyrR page on the flybase). These sequence was originally reported by Saudou
et al (1990) and Arakawa et al (1990), and I also have confirmed the
existence of this sequence by sequencing of tyrR cDNA clone that was
screened from cDNA library. You will be able to find that TyrR 5'-UTR
sequence (about 200 bp sequence of 5'-end of M60789) is consistent with
564-777th nucleotides in my sequence and with 160634-160843th nucleotides
of genomic scaffold 142000013386036. Moreover, my TyrR cDNA (I examined 3
individual clones) had additional 5'-UTR that is located upstream of 200 bp
5'-UTR. This additional 5'-UTR was about 340 bp in length and were not
reported anywhere, but this sequence was consistent with 160293-160633th
nucleotides of genomic scaffold 142000013386036 and 223-563th nucleotides
of my sequence, implying these 340 bp sequence is also 5'-UTR of TyrR. In
my opinion based on genomic and cDNA analyses, this 5'-UTR (340 bp \+ 200
bp) are the first exon (but non-coding) and next first intron is about 25
kb. The second exon (that is thought 5'-end of TyrR on the present
database, but I think it is not correct) is far from the first exon. I do
not konw why the first exon is not recorded on Drosophila genome database
(TyrR; CG7485), but I suppose that the first exon is not noticed because it
is very far from the second exon and dose not contain coding region. If you
agree with me, I hope that record of the database will be correct.
The following is the result of homology search of my sequence.
2-123th nucleotides: identical to P-lwB vector sequence
223-563th nucleotides: identical to unpublished 5'-UTR of TyrR
564-777th nucleotides: identical to 5'-UTR of TyrR (Genbank M60789)
In my conclusion, P-element of hono strain is inserted about 100 bp
upstream of TryR gene. The P-element insertional effects to TyrR in hono
mutant were described in my paper by molecular and electrophysiological
analyses (Gene (2000) 245: 31-42)
I will looking for your reply.
Sincerely yours,
\--
Mayako Kutsukake, Ph.D.
Microbial and Genetic Resources Research Group
Research Institute of Biological Resources
Tsukuba Central 6
National Institute of Advanced Industrial Science and Technology
1-1-1, Higashi, Ibaraki 305-8566, Japan
Subject: Re: about hono
Mayako-
We recently have confirmed your localization for the hono P element.
It took some time since we weren't able to get inverse PCR to work
for this element. We finally used a P and flanking genomic primer.
We were initially
looking adjacent to the wrong exon when we failed to find it. All
this could have been avoided if you had provided the precise location
of the hono P when we sent you our primers sequences well over a year
ago. In any case, I'll forward this to Rachel Drysdale & have our
skepticism removed from flybase. It would be helpful to others if
you could instruct Rachel to include the precise base coordinate of
the hono P in the Flybase entry.
I'm sorry if this has caused you any problems.
Best regards,
Jay