Gene or accession: CG3620
Release: 2
DNA error at position 267044. Upstream nucleotides: gcaaggaaaaacggaatttt
Substitution: base a should be g.
Comments: The sequencing error shown means that the Cys required for the
interchain
disulfid bridge between norpA and inaD (as described in Kimple et al EMBO J.
 20:4414-4422 (2001)) is not present in the genome project translation as the
Cys is a Tyr.
Correct sequence DNA sequence is shown in J03138; AAA28724, Bloomquist et al,
Cell  54:723-733 (1988) and the correct amino acid sequencing in the Kimple et al
paper.
Also comparing J03138; AAA28724 to translation from genome project AE003430;
AAF45942 shows the latter is missing a substantial amount of translation (I
think due to intron-exon splice error as the exons are present in the mRNA
feature).
that's all!
thanks