Subject: Helping FlyBase: ADRC-10817 Dear Nicholas, We are currently curating the abstracts for the upcoming 44th (Chicago) Annual Drosophila Research Conference, for FlyBase. I am writing in connection with your abstract: Functional Analysis of microRNAs in Drosophila. You mention genes that are new to FlyBase, mir-34, mir-100 and mir-125. Do you know which of the Genome Project CG annotations your gene corresponds to? All the CGs have corresponding gene records in FlyBase already and we don't like to make duplicate records for what is actually the same gene unless we can't avoid it. Given the nature of these genes, it is not unlikely that they won't have corresponding CG/CR genes, in which case perhaps you could send us sequence so that we could get them correctly annotated for the genome annotation project. Thank you very much for your help, with best wishes, Rachel. \---------------------------------------------------------------------- Rachel Drysdale, Ph.D. FlyBase (Cambridge), \---------------------------------------------------------------------- Subject: Re: Helping FlyBase: ADRC-10817 Dear Rachel, Here is some hopefully useful information about the genes listed above: mir-34 sequence: GGCAGTGTGGTTAGCTGGTTG predicted hairpin precursor: TTGGCTATGCGCTTTGGCAGTGTGGTTAGCTGGTTGTGTAGCCAATTATTGCCGTTGACAATTCACAGCCACTATCTTC ACTGCCGCCGCGACAAGCTAA location:AE003685 mir-34 was identified based on it sequence similarity to C. elegans mir-34, reported in Lau, Lim, Weinstein, and Bartel, 2001, SCIENCE, 294:858-862 , and its expression in flies has been confirmed by Northern blot. mir-100 sequence: AACCCGTAAATCCGAACTTGTG predicted hairpin precursor: CCATTAACAGAAACCCGTAAATCCGAACTTGTGCTGTTTTATATCTGTTACAAGACCGGCATTATGGGAGTCTGTCAAT location: AE003659 mir-100 was identified based on it sequence similarity to human mir-100, reported in Mourelatos et al., 2002, GENES AND DEVELOPMENT, 16:720-728 , and its expression in flies has been confirmed by Northern blot. mir-125 sequence: TCCCTGAGACCCTAACTTGTGA predicted hairpin precursor: GTTTGTATGGCTGATTCCCTGAGACCCTAACTTGTGACTTTTAATACCAGTTTCACAAGTTTTGATCTCCGGTATTGGA location: AE003659 mir-125 was identified based on it sequence similarity to mouse mir-125, reported in Lagos-Quintana, Rauhut, Yalcin, Meyer, Lendeckel and Tuschl, 2002, CURRENT BIOLOGY, 12: 735-739, and its expression in flies has been confirmed by Northern blot. A Northern blot of mir-125 expression in flies has also been published in the Current Biology paper mentioned above. Incidentally, mir-100 and mir-125 flank the fly let-7 sequence: mir-100 is about 500 bp upstream of let-7 and mir-125 is about 300 bp downstream of let-7. All 3 have similar expression patterns raising the possibility that they are contranscribed from the same promoter. Hope this helps, Nick _____________________ Nicholas Sokol, Ph.D. Dartmouth Medical School Department of Genetics Vail 608 Hanover, NH 03755