Subject: Question about a Transposon insertion site
Dear Flybase,
I have a Drosophila Melanogaster stock that has a P-element inserted in
one of its genes. the P- element is: p{w+mC=lacW}l(3)s2214s2214 and
the stock is purchased from Bloomington Drosophila Stock center. The
cytological map in fly base locates this P-element to be at
2945944..2975369 on chromosome 3R(84c4-6 map location). However, if I
blast the 79 bp flanking sequence of the P-element (given below)
against the drosophila genome the homology is found at the CG10061 gene
that maps to 2977094..2979905 on 3R(84c6 map location). The P-element
is inserted at 2977691. I am a little confused could you please clarify
this?
Flanking sequence:
gcgcagctgg tcgggattga tcttgaaccg ctgctttaga ccttcgccgc gacgcagaaaagggcgttta
ggcttggccThank you in advance,
Omid Toub.
Subject: Re: Question about a Transposon insertion site
I'm sorry for the confusion. I believe that no one has yet made the
connection between this insertion, p{w+mC=lacW}l(3)s2214s2214, and the
gene model, CG10061. So the location on the cytogenetic map may have been
based purely on the in situ results, and not on the sequence information.
Indeed, the BLAST results indicate that l(3)s2214 is in fact CG10061, and
the insertion maps to 2977691 on 3R.
Perhaps someone else at FlyBase has something more to add; if so, they
will chime in.
Hope this helps,
Sima Misra
FlyBase BDGP
Subject: Re: Question about a Transposon insertion site (fwd)
Camcur, Lynn,
I think that this insertion indicates that l(3)s2214 and CG10061 should be
merged. What do you think? The BLAST puts it firmly within an exon of
CG10061.
\-sima