Subject: data on deletions near 50C
RE: 50C molecular analysis of deletions et al.
I have characterized the endpoints of eight of the deletions in the 50C region
created by Christine R. Preston in the Engels' lab ( Preston et al., 1996
Flanking duplications and deletions associated with P-induced male
recombination in Drosophila. Genetics 144(4): 1623--1638  <up>FBrf0091145</up>). The
deletions were caused by 'HEI', hybrid element insertion, an aberrant effect
of P element mobilization. These eight deletions retain a CaSpeR element at
the original insertion site but have flanking deletions extending proximally
or distally. I used TAIL PCR (Liu YG, Whittier RF. 'Thermal asymmetric
interlaced PCR: automatable amplification and sequencing of insert end
fragments from P1 and YAC clones for chromosome walking.' Genomics. 1995 Feb
10; 25(3): 674-81) to amplify the (unknown) deletion junctions and then
sequenced the resulting products. I also used TAIL PCR to determine the
position of the P element insertion in the peanuts (pea1) mutant stock. The
data are listed below.
For reference, the starting element, P{CaSpeR}Cp150C (FBti0004219) which
remains at the left or right boundary of all these deletions has the 8 bp
target duplication of GATTGGGC corresponding to nucleotide position 9029183 to
9029190 of the sequence of chromosome arm 2R  release:3.1 
Df(2R)50C-36
FBab0026827
The deletion extends ca. 43 kb distally from the end of P{CaSpeR}Cp150C.
The sequence flanking the 3' end of the P element was determined approximately
as tcgtcgccggcgatttttta, corresponding to nucleotide position 9071823 of the
sequence of chromosome arm 2R  release:3.1 
Deletes from the middle of Cp1 to near the start of shorter mam transcripts
and all the genes between.
Deletes part of Cp1, deletes all of Aats-phe, CG6704, CG18568 CG6701, CG13350,
CG8067, RN-tre, CG30482 and part of mam.
Df(2R)50C-38
FBab0026828
The deletion extends ca. 211 kb distally from the end of P{CaSpeR}Cp150C.
The sequence flanking the 3' end of the P element was determined exactly as
cgccacacgctttatgtaac, corresponding to nucleotide position 9239710 of the
sequence of chromosome arm 2R  release:3.1 
Deletes from the middle of Cp1 into the middle of cg and all the genes between.
Deletes part of Cp1, deletes all of Aats-phe, CG6704, CG18568 CG6701, CG13350,
CG8067, RN-tre, CG30482, mam, CG18371, Prosap, CG13353, CG8233, CG8241,
CG13018, CG13016, CG8257, O-fut1, CG8309, CG8323, CG18327, CG18324, CG8331,
mRpS16, and part of cg.
Df(2R)50C-40
FBab0026829
The deletion extends ca. 44 kb distally from the end of P{CaSpeR}Cp150C.
The sequence flanking the 3' end of the P element was determined exactly as
gtacacagcataacataatt, corresponding to nucleotide position 9073066 of the
sequence of chromosome arm 2R  release:3.1 
Deletes from the middle of Cp1 to near the start of shorter mam transcripts
and all the genes between.
Deletes part of Cp1, deletes all of Aats-phe, CG6704, CG18568 CG6701, CG13350,
CG8067, RN-tre, CG30482 and part of mam.
Df(2R)50C-68
FBab0026833
The deletion extends ca. 6.7 kb proximally from the end of P{CaSpeR}Cp150C.
The sequence immediately flanking the 5' end of the P element was determined
approximately as aaaaaaacatacaggctgcc, corresponding to nucleotide position
9022521 of the sequence of chromosome arm 2R  release:3.1 
Deletes part of Cp1, all of CG13349 and into the longer transcripts of AGO1.
Df(2R)50C-81
FBab0026836
The deletion extends ca. 7.3 kb proximally from the end of P{CaSpeR}Cp150C.
The sequence immediately flanking the 5' end of the P element was determined
roughly as tacaaaattatgaatctttc, corresponding to nucleotide position 9021881
of the sequence of chromosome arm 2R  release:3.1 
Deletes part of Cp1, all of CG13349 and into the longer transcripts of AGO1.
Df(2R)50C-85
FBab0026837
The deletion extends ca. 7.6 kb proximally from the end of P{CaSpeR}Cp150C.
The sequence immediately flanking the 5' end of the P element was determined
approximately as atatccccgccatccacgtc, corresponding to nucleotide position
9021603 of the sequence of chromosome arm 2R  release:3.1 
Deletes part of Cp1, all of CG13349 and into the longer transcripts of AGO1.
Df(2R)50C-102
FBab0026816
The deletion extends ca. 10.2 kb proximally from the end of P{CaSpeR}Cp150C.
The sequence immediately flanking the 5' end of the P element was determined
approximately as gacattatttatgttttttt, corresponding to nucleotide position
9019018 of the sequence of chromosome arm 2R  release:3.1 
Deletes part of Cp1, all of CG13349, most of CG33184 and into the longer
transcripts of AGO1.
Df(2R)50C-129
FBab0026821
The deletion extends ca. 27 kb distally from the end of P{CaSpeR}Cp150C.
The sequence flanking the 3' end of the P element was determined exactly as
gttttagcgctcgaaaattg, corresponding to nucleotide position 9055955 of the
sequence of chromosome arm 2R  release:3.1 
Deletes from the middle of Cp1 to near the start of longer mam transcripts and
all the genes between.
Deletes part of Cp1, deletes all of Aats-phe, CG6704, CG18568 CG6701, CG13350,
CG8067, RN-tre and probably part of mam.
P{A92}pea1
FBti0003542
This P element is inserted in the 5' end of CG8241 but also in CG8233.
The sequence immediately flanking the 3' end of the P element was determined
exactly as AGCTGAACTAGTACTCATCG. Bases 1 to 8 of this sequence correspond to
the 8 bp target duplication which are at nucleotide position 9217995 to
9218002 of the sequence of chromosome arm 2R  release:3.1 
N.B. there is a sequence polymorphism at positions 17 & 18 of the sequence
given above relative to the  release:3.1  reference sequence, which is
agctgaactagtactctccg.
The mutant phenotype of pea could result from disruption of either CG8241 or
CG8233, but my guess would be that the male sterility is caused by disruption
of CG8241 because it appears to be an RNA helicase/pre-mRNA splicing factor.