Subject: flies are on the way \- descriptions Dear Rachel and Kevin, I have just FedEx'ed 6 fly lines to Kevin \- 2 bw; 1 f; and 3 kar. Attached is a file with their descriptions. Also, I sent the remaining 2 bw lines to Troy Zars. Please let me know if something goes wrong. Best, Alex February 14, 2006 Submission of six strains to the fly collection All the mutant alleles were produced by EMS. EMS treatment was done by David Houle (Florida State Univ.), isolation was done by Alex Kondrashov and Tim Kondrashov, and sequencing was done by Matt Dean (Univ. of Arizona). I) Locus bw (brown) I.1. Allele bw16 (our internal name was bw6, but it is already taken) GCG > GTG (Ala > Val) missense substitution in codon 78: CTGGCGGCGATTTCG > CTGGCGGTGATTTCG I.2. Allele bw19 (our internal name was bw9) CAG > TAG (Gln > TERM) nonsense substitution in codon 102: CGGCATCAGATGACG > CGGCATTAGATGACG II) Locus f (forked) II.1. Allele f15 (our internal name was f5, but it is already taken) CAG > TAG (Gln > TERM) nonsense substitution in codon 206 of isoform C: GTCCAGGATCAAGGT > GTCTAGGATCAAGGT III) Locus kar (karmoisin) III.1. Allele kar22 (our internal name was kar2, but it is already taken) GGC > GAC (Gly > Asp) missense substitution in codon 92: TGCAACGGCATCATC > TGCAACGACATCATC III.2. Allele kar23 (our internal name was kar3, but it is already taken) CCGGTCATGTGTATCGGCATCACC > CCGGTCATCACC (LPVMCIGITS > LPVITS) inframe deletion of 12 nucleotides (codons 338-341) III.3. Allele kar20 TGT > TAT (Cys > Tyr) missense substitution in codon 415: GAGATCTGTGGCCCC > GAGATCTATGGCCCC