Subject: FB Help Mailer: 682 Gene model correction
comments: To whom it may concern,
we have started to molecular- genetically analyze the genomic sequence of the serotonin transporter gene (SerT) CG4545 (flybase ID: FBgn0010414). While sequencing w1118 and 5 additional mutants in this gene, which we generated via P{XP}d04388- element jump out, we detected 278 additional basepairs, which are located in the first intron of the gene. The exact starting point is after base 20297464 (adenosine).The sequence of the additional basepairs is as follows: 
AGGGAGGCATTCAAAGTAGCAGATTTTGCACTGATTTCCGACCGATTTGGGATGCCCAATATAGTGGTTAAAAAACATTTAAATG
CTGCGGTCACGGGCATTGCAGCGGTTTTAAACGCTGCCATGGCCTCCAAAGAAATATTCAATGCCAATGTCGTAAAATAT
TGCGATTTCGGTTAACTACTTTCGGGGCTTATACTTAATTTACACTTTAAATTACGCACTGTACACCACGGCGTATGCTT
AACGAGATTCATGCGTTTTCAATGCAGCCTTGA
Then it's connected up as it is already known: 20297465 (TCTTCTTTCAAACCCCTTT...)
This information might be useful for other researchers. For further information please don't hesitate to contact us. 
Best regards
Andrea Kaiser
AG Scholz
University of Wurzburg, Germany