Open Close
Reference
Citation
Zimmerman, S. (2010.12.1). Sequencing of the Gal4c415 insertion site. 
FlyBase ID
FBrf0212436
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication
The Gal4c415 driver line (Manseau, et al., 1997. Dev Dyn 209, 310-322) was created by the insertion of p{GaWB} (Brand and Perrimon, 1993. Development 118, 401-415) on chromosome 3.
   We have sequenced the Gal4c415 insertion site using the BigDye Terminator Sequencing Kit. p{GaWB} is inserted in the plus direction on 3L at cytological location 77C7. The genomic DNA at the 3' end of the p-element starts at nucleotide 20519243. It is located in CG4825 and upstream of CG4858.
   The sequence is shown below, split into P element and genomic sequence:
   P element (3' end):
   ACNGATACCTCCTAAGGGACAAAGCTGGTACCCGCCCGGGGATCAGATCCGCGGCCGGCCGCATAGGCCACTAGTGGATCTGGATCCTCTAGCTAGAGCTTTGCGTACTCGCAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAATTAATATTATGAGTTAATTCAAACCCCACGGACATGCTAAGGGTTAATCAACAATCATATCGCTGTCTCACTCAGACTCAATACGACACTCAGAATACTATTCCTTTCACTCGCACTTATTGCAAGCATACGTTAAGTGGATGTCTCTTGCCGACGGGACCACCTTATGTTATTTCATCATG
   Genomic DNA at 3' end of GawB:
   GCTTGGACCAATAAAAATCGACACTTGCCGGCGGTGGTGTTGCCGGAGGGTTGAAATGTGTGACTTGATAACAGGGGCGTTGCCAGATGAATAGCGGAACGTTGGGGGTGATCCAGGTATCTTATGATGACAAATATTTTGTATATTTTCAGATCGTATTCGAAAAGCAGTCATCACCCTACTTTATAACAAGATTATATTGTCACTATTTTAGAGTTATATAGCGTTAGTTATATAACTTAGTTCTTTACCTTATTTTTTCTATATAATAACTTTCTAGGCAGCATTTATGGCATTCCCGAGGATAAAATGATTTTTCGTTTACAAACAGTCAAATAATAATGAGGTCACGCATAACATTATTCAGATTGGATATTTCAACATAGTGGAATCCTGGAACACCCCTAATGCTATGACTGTAGCCCTGAACAGCTGATTGCACTTGTTGACTAAAACGCAATCCACGACTTTGCATTGGTTTCGGAATAAATTGCTTTTAAATCGCTTTATAATGCTGGACAAGGTTAAAAATGTTATCTAGTGCTATCAGGCAAGGGCGGAGTANGAAANTCCACAGTGAGCACCCAATTATCGCTGGCACTGCGAAAAAACGGATTTAAGGTAGCCCAACCATTTCNCCNCAAAACATTACCGAGGANTTTGANGGNACTCATATGAACAATCTATAAGGTGGNCTGCTCGATAAAATCTGNGNGGACGAGNGN
DOI
Associated Information
Comments
Associated Files
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Alleles (2)
    Genes (3)
    Insertions (1)