The following information accompanied stocks donated to the Bloomington Stock Center by Joost Schulte, Massachusetts Institute of Technology.
P{UAS-Mob4.RNAi.JS1} was generated in the lab of Norbert Perrimon as part of the TRiP Project. The Mob4 hairpin spans exons 1 and 2 and is 595 bp in length. PCR primers used to generate the hairpin construct are GCATACTACGGTGCAGGGAT (forward) and ACGACTCCTTGATGGACACC (reverse). Pupal lethality results when the construct is crossed to P{GAL4-da.G32}, actin-GAL4 or tubulin-GAL4.
P{UAS-Mob4.RNAi.JS1}attP2 is a phiC31 integrase-mediated insertion into P{CaryP}attP2 at 68A4, 3L:11063638..11063638 (R5 flank).