The Bx7 allele was generated by mobilizing the P{GawB}Bxhdp-G14-1 element using P{Δ2-3} as the source for transposase. Hop-outs from the F1 were balanced over FM7a followed by screening of the F2 progeny for white eye (excision of P-element results in white eye). These white eyed females were crossed with wild type males and the resulting F3 males were screened for held up wings (since, as reported earlier, Bx loss of function alleles showed held-up wing phenotype). Isolated hop-out allele Bx7, which showed held up wings, was maintained over a duplication of the Bx locus on the Y chromosome, Dp(1;Y)W39 29.
Molecular lesion: to identify the region deleted in Bx7, its genomic region was amplified using primers 5’GGCTCGTTGGTCTAGAGGTA3’ and 5’CTTGCGGAGATGCCATTATG3’ and the amplified product was sequenced. The bases from  X:18566342  to  X:18568237  (1896 bases from X-chromosome region FBgn0265598 X : 18515428..18572809) are deleted in the Bx7 allele of Bx. The flanking sequences for the deleted regions are:
5' : 5'TAGAAGAAGACTCAGTAG3'
3' : 5'CGGTCCACCAGAAACCTCCGG3'
Since it was imprecise excision, we really don’t know exact location of P{GawB}Bxhdp-G14-1, but will be fall within that 1896 bases mentioned above.