The sequences of the regions surrounding the brun105 and brun141 deletions are shown below. The sequencing was done as described in the method section of FBrf0238107, the sequencing primer was ACCCATGTGAAGGAGTGCAG. This should help clear up any confusion from the alignments in Figure S2. The coordinates in Figure S2 refer to Release 6 of the Drosophila genome. brun141 NNNNNNNNNANNGGCNAANCGTGGTGAAAGCAGGCGCTGACTGACCACGAAAAGGGGGAGGAGGTGGCTCCTCTGAAGAA ATCGAATCCAATCGAGAGCTTATCCACTTGACAGCGGTATGGAACGCCTGTCTAGCGCCAAGCATTATACATTTTGATAA CGAAGCTCGTGTTTAAAAAATATTTTTATACAATTACCGGGGCAATACACATGTATCATAATGAACTACATATTAAGATT GTTGCTAAAGAAATTATGCCAATGAAATGTGTGAATAACTGTAGTGTAAAAGCAATAAACTCTATTTGACGAAACATTTG GTGTCTTTGGTTTCTCCTTTTTAGCCGAGTCTTCGTATCTCGTCCATGGNGAAAATCCGAAN The alignment for brun141 is correct as shown in the Figure S2D. Unfortunately, the size of the deletion is incorrect in the figure and should be 4942 base pairs. brun105 NNNNNNNNNNNNNGGCNNNNNGTGGTGAAAGCAGGCGCTGACTGACCACGAAAAGGGGGAGGAGGTGGCTCCTCTGAAGA AATCGAATCCAATCGAGAGCTTATCCACTTGACAGCGGTATGGACAGCGGTATGCCACGCCAAGCATTATACATTTTGAT AACGAAGCTCGTGTTTAAAAAATATTTTTATACAATTACCGGGGCAATACACATGTATCATAATGAACTACATATTAAGA TTGTTGCTAAAGAAATTATGCCAATGAAATGTGTGAATAACTGTAGTGTAAAAGCAATAAACTCTATTTGACGAAACATT TGGTGTCTTTGGTTTCTCCTTTTTAGCCGAGTCTTCGTATCTCGTCCNNGNNAATCCGTTANNN The start of the deletion in brun105 is confusing from the alignment in Figure S2D. Most of the sequence shown for the left breakpoint is an insertion. Only the left most G aligns to the WT sequence. I noticed however that it might be more accurate to slide the sequence of the deletion one nucleotide to the left. The size of the deletion is then 4946 instead of 4948 nucleotides.
