FB2026_02 , released June 18, 2026
Reference Report
Open Close
Reference
Citation
Myers, L., Kidd, T. (2019.3.22). Location data for Ret deletions. 
FlyBase ID
FBrf0241880
Publication Type
Personal communication to FlyBase
Abstract
PubMed ID
PubMed Central ID
Text of Personal Communication 
A file with the deletions highlighted is in the associated files.
 Summary:The  deleted bases are capitalized.
RetLM1 is a single base deletion earlier in the open reading frame with the frameshift leading to a stop codon after two amino acids.
atggagtcaactactattgtttttgtgactctgctcacaattataacccaacgtaaacac
M  E  S  T  T  I  V  F  V  T  L  L  T  I  I  T  Q  R  K  H
tgtgcggccgtcgatgtttactttcccaccAcgtcggtgaaattcaatatgcccatcaat deleted in RetLM1
C  A  A  V  D  V  Y  F  P  T  T  S  V  K  F  N  M  P  I  N
RetLM2 is an in-frame 18 base pair deletion at or very close to the calcium binding site at the start of the cadherin like domain.
caactgcgattctcccgaaacggtgtcttccggGAAACCCCCTATTGTGTGtccttggag deleted in RetLM2
Q  L  R  F  S  R  N  G  V  F  R  E  T  P  Y  C  V  S  L  E 
RetLM3 is a single base deletion in the same location as RetLM2 that leads to a frameshift.
caactgcgattctcccgaaacggtgtcttccgggaaaccccctatTgtgtgtccttggag
 Q  L  R  F  S  R  N  G  V  F  R  E  T  P  Y  C  V  S  L  E  deleted in RetLM3
DOI
Related Publication(s)
Research paper

The Drosophila Ret gene functions in the stomatogastric nervous system with the Maverick TGFβ ligand and the Gfrl co-receptor.
Myers et al., 2018, Development 145(3): dev157446 [FBrf0238088]

Associated Information
Comments
Associated Files
File date: 2019.3.22 ; File size: 14596 ; File format: docx ; File name: Kidd.2019.3.22-Ret_deletions.docx
Other Information
Secondary IDs
    Language of Publication
    English
    Additional Languages of Abstract
    Parent Publication
    Publication Type
    Abbreviation
    Title
    ISBN/ISSN
    Data From Reference
    Alleles (3)
    Genes (1)