First, we have noticed that in our stock used to make the CRISPR mutants (BL 51323), the daed gene actually carries a mutation in the start codon, which leads to a 7aa N-terminally truncated protein. It might be worth highlighting this or perhaps even adding this as a variant.
The daedΔ2* mutant is a deletion that removes the ‘new’ start codon 21nt downstream of the annotated one and results in a putative truncated protein that would lack the SAM domain. The sequences flanking the deletion are as follows:
daedΔ2 upstream
TAATTTAATTGCCATTATTGACAGAGTTTAaGGCAACGAAGACGCACACA
daedΔ2 downstream
CATTCAGTTTGAGGCCACAAAGAACTTTCACTCGCACACCGAGCAGAAGG
For daedoof1 the situation is a little more complex, as there are some base substitutions in addition to the deletion that cause this mutant to go out of frame very near the start codon.
daedoof1 upstream
TTAATTGCCATTATTGACAGAGTTTAaGGCAACGAAGACGCACACAATGT
daedoof1 downstream
ATTCAGTTTGAGGCCACAAAGAACTTTCACTCGCACACCGAGCAGAAGGA
With the following bases left in this mutant between the above sequences: ttCa