Wdr2034 – The sequence of the insertion is ACATTGTACG. Wdr2033 - The sequence of the insertion is CT. Uaf13 – The sequence of the insertion is CATAGTACTTTG. Usp12-461 – The deletion starts at genomic position 22775329. (junction sequence 5’ of deletion: GATCAATCACATCAATGAGATC, junction sequence 3’ of deletion: GGCTACATACTGTTCTATCAGTCGCGG) Usp12-4621 : The 5 bp deletion starts at genomic position 22775157. (junction sequence 5’ of 5 bp deletion: CAAGAGGCCCAAGGAGACGCTGCTGTC, junction sequence 3’ of 5 bp deletion: TGGCGGATCTGTTCTACAGCATTG) The 3 bp deletion starts at genomic position 22775326. (junction sequence 5’ of 3 bp deletion: CTTTCTGATCAATCACATCAATGAG, junction sequence 3’ of 3 bp deletion: ATACTGGCCGAACGGAATGCAGGGCC)