After checking the data and the manuscript, we found that we made a mistake in the annotation of nAChRalpha7earlystop. The sequence TGGTCAGG in the WT: ATGAAGAAGCCATCACGCAGTCGGCCAGACAATCCATCCTGCCC TGGTCAGG ATAGA was mutated into ATCCTATCT in the mutant line: ATGAAGAAGCCATCACGCAGTCGGCCAGACAATCCATCCTGCCC ATCCTATCT ATAGAAC which resulted in mutation of the amino acid sequence from MKKPSRSRPDNPSCPGQDR to MKKPSRSRPDNPSCPSYL*