The Bloomington Stock Center received a stock with the Vinc33.2 allele from Nick Brown, University of Cambridge, who said the allele was generated by imprecise excision of P{EP}G1390 in the same screen that generated Df(1)Vinc2 (Klapholz et al., 2015; FBrf0227964). Whole-genome sequencing by the University of Minnesota Model Organism Sequencing Service showed that Vinc33.2 is an intragenic deletion extending from the first intron to the second intron, removing the first coding exon. The sequence of the breakpoint junction is
TAGTCGCTAGTTGGAAGGCC|CC|AGCCAGTGGGAGCACAGAGT
The two C bases at the breakpoint junction may be  X:2219005  and 2219006 from the left side of the deletion or  X:2221438  and 2221439 from the right side of the deletion or  X:2219005  and  X:2221439 . Consequently, the breakpoint may be depicted  X:2219004--2219007 ; X:2221437--2221440 .
Dr. Brown noted that Vinc33.2 behaves as a weaker allele in complementation tests than Df(1)Vinc2, which removes the entire Vinc coding sequence and sequences in one or more adjacent genes. This observation suggests that the remaining Vinc coding sequences in Vinc33.2 may be translated from an alternative start site.