hypomorphic allele - genetic evidence

Intragenic deletion extending from the first intron to the second intron of Vinc (this removes the first coding exon). The sequence of the breakpoint junction is TAGTCGCTAGTTGGAAGGCC|CC|AGCCAGTGGGAGCACAGAGT. The two C bases at the breakpoint junction may be X:2219005 and 2219006 from the left side of the deletion or X:2221438 and 2221439 from the right side of the deletion or X:2219005 and X:2221439 . Consequently, the breakpoint may be depicted X:2219004..2219007 ; X:2221437..2221440 . The Vinc^33.2 mutant behaves as a weaker allele in complementation tests than a mutation that removes the entire coding sequence (Df(1)Vinc²), suggesting that the remaining Vinc coding sequence in Vinc^33.2 may be translated from an alternative start site.