We recently collaborated with the Model Organism Sequencing Service at the University of Minnesota Genomics Center to sequence and analyze assorted chromosomal deletion stocks. When we examined the sequence of stock
1467    Dp(3;1)P115/+; Df(3R)P115, e11/TM1
we found the ebony gene has an intragenic deletion with breakpoints  3R:21 ,231,947-21,231,948; 3R:21 ,232,394-21,232,395. Fifteen bases are inserted at the breakpoint junction to give the sequence
.. ACAAACTCAGTTGCTTCTTG|TATGCTTCTTGTAGT|ATGCTCTCGTGCGGCAGACG..
In other words, the new order of the chromosome is
3Lt -  3R:21 ,231,947|TATGCTTCTTGTAGT| 3R:21 ,232,395 - 3Rt
We found the identical sequence in another e11 stock
497      e11
Interestingly, Perez and Quesada-Allue (2001; FBrf0150694) described the same breakpoint structure for the more common e4 allele.
Stern (1926; FBrf0001532) isolated e11 as a spontaneous mutation, and one would expect e11 and e4 to have different structures. These results suggest that e11 and e4 stocks were swapped a long time ago - prior to the isolation of Tp(3;1)P115. It is possible that all stocks now labeled "e11" actually carry e4, and that the original e11 is lost.