X:15,824,077..15,824,233 [+]
One copy of repeat shown.
Sequence
Sequence DownloaderCCACAATCGTTTGCTCCTTTGGCAAGCAAGTGGTGGAGAAGGTGGAAAGCGAGTACTCTCGACTGGAGAACAATCGCTAC GTCTATCGCATTCAACGCTCCCCCATGTGCGAGTACATGATCAACTTTATTCAGAAGCTGAAGAACCTACCGGAACG
genomic DNA
CCACAATCGTTTGCTCCTTT
CGTTCCGGTAGGTTCTTCAG
Collection of stocks carrying UAS-RNAi transgenes, each designed to target a single protein-coding gene; use a targeted insertion site.
NOTE: Dataset members correspond to the amplicon sequence features; these can be used to retrieve associated constructs and stocks.
The phiC31 RNAi library (KK) was created using the phiC31 integrase system to target RNAi transgenes to a specific landing site on the second chromosome. This insertion site (P{attP,y+,w3'}VIE-260B) was selected based on its low level of basal expression and consistent high level of GAL4-dependent expression across a range of different tissues. The RNAi transgenes consist of inverted repeats that were designed to reduce the risk of off-target effects.
The host strain used for transgene integration actually has two landing sites: the annotated site in the 5' UTR of tio at R6:2L:22 ,019,296 (P{attP,y+,w3'}VIE-260B), and a previously non-annotated site at R6:2L:9437482 (P{attP,y+,w3'}VIE-260B-2). The previously non-annotated site seems to be the main integration site, occupied in all 39 lines tested. The originally annotated site was occupied in only 9 of 39 lines tested.