2R:11,528,737..11,528,757 [-]
Sequence
TTCAATTAACCAGTTAAATGTG
eve protein
zen protein
en protein
experimental
Binding site k2 in the en upstream region is bound by eve and zen and weakly by prd and en. eve-binding site k2 contains an inverted repeat similar to the consensus sequence TCAATTAAAT.
Binding site k2 in the en upstream region is bound by eve and zen and weakly by prd and en. eve-binding site k2 contains an inverted repeat similar to the consensus sequence TCAATTAAAT.