Open Close
General Information
Symbol
Dmel\GMR36B06
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000163947
Collection
Associated gene
Genomic Location
Chromosome (arm)
3L
Sequence location

3L:12,316,300..12,320,246

Sequence Data
Length
Comments
Associated Information
Gene(s) (targeted or local)
Transcripts(s)
    Polypeptide(s)
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      gaaaccatagcaagtccccactgtc
      
      Primer 2
      cgggacagtgcggaacggagctgta
      
      Comments
      Collection Information
      Comments

      evidence: Reporter construct (in vivo)

      Stocks (1)
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      REDfly - A database of transcriptional regulatory elements
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      GMR36B06
      Secondary FlyBase IDs
        References (4)