Open Close
General Information
Symbol
Dmel\GMR82G02
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000167607
Collection
Associated gene
Genomic Location
Chromosome (arm)
3R
Sequence location

3R:4,872,217..4,875,320

Sequence Data
Length
Comments
Associated Information
Gene(s) (targeted or local)
Transcripts(s)
    Polypeptide(s)
      Experimental Data
      Progenitors
      PCR template
      Primer 1
      cacaactgcaaattcgggctgacac
      
      Primer 2
      ggtgggtgtattttgggaaaccgct
      
      Comments
      Collection Information
      Comments

      evidence: Reporter construct (in vivo)

      Stocks (2)
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (5)