2R:22,037,337..22,039,531
genomic DNA
TGGGGAATTCCTAATGGAACCTTGG
GGTCGTGTCGTCGTGGTGGCTT
A collection of stocks carrying GAL4 transgenes fused to putative enhancer fragments from selected D. melanogaster genes; a targeted insertion site is used.
7,705 candidate enhancer sequences were PCR amplified from genomic DNA, covering 13.5% of the entire non-coding and non-repetitive genome; genomic fragments were 2kb on average, and typically overlapped ~400bp to avoid splitting enhancers. Candidate enhancer fragments were cloned into the pBPGUw vector, upstream of a Drosophila synthetic core promoter (DSCP) that contains the TATA, Inr, MTE, and DPE sequence motifs, and a Scer\GAL4 reporter gene. These constructs were integrated into the P{CaryP}attP2 target element on chromosome 3L by phiC31 site-specific integration, as described elsewhere (FBrf0205679).