The P{white-eraser} transgene is designed to mutate a w[+] minigene marker (a common marker used in many transgenes) present in a transgene already integrated into the genome. P{white-eraser} consists of 1. two homologous DNA fragments that target a w[+] minigene marker, 2. A Disc\RFP^{DsRed.3xP3.cUa} marker (this is located in between the two homologous DNA fragments), 3. sgRNAs that target the w[+] minigene (two copies of two different sgRNAs are expressed under the control of the U6 promoter, the sequence of the two sgRNAs is CCGCAGTCCGATCATCGGATAGG and CTTCTTCAACTGCCTGGCGCTGG), 4. a Avic\GFP^3xP3.cUa marker and 5. a source of Cas9 (Spyo\Cas9^Act5C.PU). The sgRNAs and Cas9 target the w[+] minigene marker present in the targeted transgene, and repair can occur either via homology directed repair (HDR) or non-homologous end joining (NHEJ). If repair occurs via HDR it is expected that the Disc\RFP^{DsRed.3xP3.cUa} marker flanked by the two homologous DNA fragments is inserted into the target w[+] minigene marker, mutating the w[+] minigene (and allowing selection via the Disc\RFP^{DsRed.3xP3.cUa} marker). If repair occurs via NHEJ, an indel mutation should be introduced into the target w[+] minigene marker, rendering it non-functional (this chromosome containing the mutated target transgene can be distinguished from the chromosome containing the P{white-eraser} transgene due to the lack of the Disc\RFP^{DsRed.3xP3.cUa} marker).