A Cas9 reporter, or 'GFP SSA reporter (GSR)', based on gRNA-induced single-strand annealing (SSA) that carries an interrupted EGFP-2A-nGFP coding sequence driven by a Ubi-p63E enhancer. Cas9 activity will trigger double-strand breaks at the site of interruption and result in reconstitution of the reading frame and expression of both a cytosolic EGFP and a nuclear GFP. Specifically, the construct contains a Ubi-p63E enhancer regulating expression of EGFP coding sequence for amino acid 1 to amino acid 175, a synthetic fragment (CCGTCTGTCACAGGATTGGCTGCTTG) that serves as gRNA targeting sites, EGFP coding sequence for amino acid 43 to amino acid 233, T2A (the 'self-cleaving' 2A peptide), a nuclear localization signal, and sfGFP coding sequence. Two gRNA targeting sequences for the synthetic fragment, expressed ubiquitously via the snRNA:U6:96Ac ( U6:3 ) promoter and separated by a Drosophila tRNA-Gln (Q) spacer, are also included in the construct. The 2.1 gRNA scaffold (which includes an additional extension of the second stem loop compared to the (F+E) gRNA scaffold described in FBrf0241409) is used.