UAS sequences are fused upstream of coding sequence in which the reading frame has been interrupted by inserting a SEED ('scarless editing by element deletion') cassette that contains a Disc\RFP^{DsRed(T1).3xP3.cHa} marker flanked on the 5' side by 3 copies of the target site for the 'gRNA#1' guide RNA (sequence of this guide RNA is GTAGTACGATCATAACAACG) and on the 3' side by 3 copies of the target site for the 'gRNA#2' guide RNA (sequence of this guide RNA is GTACATCCATACAGTACCAG) (both of these guide RNAs have no target site in the wild-type D. melanogaster genome), and with the 5' and 3' parts of the interrupted coding sequence sharing a repeated sequence of ~100bp. If double-strand breaks are induced at both guide RNA target sites (by providing Cas9 and both of the 'gRNA#1' and 'gRNA#2' guide RNAs), single-strand annealing (SSA) repair can seamlessly remove the SEED cassette (including the Disc\RFP^{DsRed(T1).3xP3.cHa} marker) and reconstitute a functional coding sequence that encodes the Tag:ALFA and Tag:HA tags in tandem.