UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets skd (this hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA) and the second targets kto (this hairpin contains an inverted repeat of CAGATGCTACGACAACGACAA).
UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets skd (this hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA) and the second targets kto (this hairpin contains an inverted repeat of CAGATGCTACGACAACGACAA).