UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets skd (this hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA) and the second targets kto (this hairpin contains an inverted repeat of CAGATGCTACGACAACGACAA).
Scer\GAL4ey.PU, ktoTH00508.N, skdTH00508.N has visible | adult stage phenotype
Scer\GAL4nub-AC-62, ktoTH00508.N, skdTH00508.N has abnormal mitotic cell cycle | larval stage phenotype
Scer\GAL4ey.PU, ktoTH00508.N, skdTH00508.N has decreased size | adult stage phenotype
Scer\GAL4ap-md544, ktoTH00508.N, skdTH00508.N has decreased size | larval stage phenotype
Scer\GAL4en.PU, ktoTH00508.N, skdTH00508.N has abnormal size | larval stage phenotype
Scer\GAL4ey.PU, ktoTH00508.N, skdTH00508.N has eye phenotype
Scer\GAL4ap-md544, ktoTH00508.N, skdTH00508.N has wing | P-stage phenotype
Scer\GAL4ap-md544, ktoTH00508.N, skdTH00508.N has wing disc dorsal compartment | larval stage phenotype
Scer\GAL4en.PU, ktoTH00508.N, skdTH00508.N has wing disc | larval stage phenotype
Scer\GAL4nub-AC-62, ktoTH00508.N, skdTH00508.N has wing disc | larval stage phenotype