Open Close
General Information
Symbol
Dmel\Tom40-RA
Species
D. melanogaster
Annotation Symbol
CG12157-RA
FlyBase ID
FBtr0071073
Feature type
Associated gene
Evidence Rank
Length (nt)
1676
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 102 )
Sequence
GTCTTACCATCTGGTAACACTGGTCGAGACATAATAACCTCCGATATAGAAGTCCGATATCGAAACGTGTTGGCTTTGAA
ATTACATAGATTACATCGGGACATTCGAAATGGGCAACGTGCTAGCGGCTTCCTCCGGCGCCCCAGGCAGTGGCGCCTCA
AATCTGGGCCTCGGCCTACAGGAACCGGCTCCCCTGCCCTCTAATTCCGGCTCACTGACCGAATCCTCTTCGTCCGCCGA
AGGCTTGGACTCACTTGCCGCCGCCAAGGACGCAGCGCTGGAGAATCCCGGCACCGTTGAGGAGCTTCACAAAAAGTGCA
AAGATATCCAGGCCATCACCTTCGAGGGCGCCAAGATCATGCTGAACAAGGGCCTGAGCAACCACTTCCAGGTGTCGCAC
ACCATCAACATGAGCAATGTGGTACCCAGTGGATATCGCTTCGGAGCCACCTATGTGGGCACCAAGGAGTTCAGCCCCAC
GGAAGCTTTTCCCGTGCTCCTGGGCGACATCGATCCGGCTGGCAACCTCAACGCCAATGTTATCCATCAGTTCTCTGCCC
GTCTGCGCTGCAAATTCGCTTCGCAGATCCAGGAGTCCAAGGTGGTGGCCTCACAGCTGACGACCGACTATCGCGGTAGT
GATTACACCCTCTCGCTGACGGTGGCCAATCCCAGCATATTCACCAACTCCGGCGTGGTCGTTGGCCAATATCTCCAGTC
AGTCACTCCAGCCCTCGCCCTGGGCTCCGAACTGGCCTACCAGTTCGGTCCGAACGTCCCCGGCCGTCAGATAGCTATTA
TGTCCGTCGTGGGCCGCTATACGGCTGGAAGCTCGGTGTGGTCGGGGACTCTGGGTCAGAGCGGTCTGCACGTGTGCTAC
TACCAGAAGGCCAGCGACCAGCTGCAGATCGGTGCCGAGGTGGAGACCAGTCTGCGGATGCAGGAGTCGGTGGCCACGTT
AGCGTATCAGATCGATCTGCCCAAAGCGAATCTGGTCTTCAGAGGCGGAATTGATTCCAACTGGCAAATCTTTGGTGTTT
TGGAGAAGCGTCTGGCTCCATTGCCATTCACACTAGCCCTGAGCGGACGCATGAACCACGTGAAGAACAACTTTAGACTC
GGCTGCGGGCTGATGATCGGCTAAGCCGGATCTTTGGACGGCCATTATCTACTTCAGCCTCAGACCCCAAGCACACACCC
ATCCATTGTAACTTTTTCACATCATCCGCTAACAACAAGAAGAAGAACAACAACAAACAAAGAGATATATAAATCTGCTA
ACAAACTTTTTTTTATGATAATCTGTCTGTCGCTTGTGTGTATAAAAAATGCCTTGCATTGCAAAAGAGGCGGCCAGCAG
GGATCTGGGATCCTATGGAATGGCTTTTATTCTTTGATCCATTATGTACCAGTGTGCCACTGTTTGTCGTCCGTTGTTAA
TCGATCAATTTAACCCACTGACAGAGTCATAAATGCGGAGTTCAAAATACAAGAATGAAAACTATTCCACAATTAGTATA
CATTTCTTCACTGAATACACACACACACACACACATCCAAAAGAAACATACAACAAGAAACTATCACTGTACATTTTATG
TTGCTTCCTAAACGTACGCATTTATTTAGAACAACCAGCTATTTCCTCCAGACAAACAAAAATGAATTAAATAATT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0071074
1861
FBtr0333748
2395
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0071031
344
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0089237
344
FBpp0305890
344
Comments
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG12157-RA
Tom40-RA
Secondary FlyBase IDs
    References (2)