Open Close
General Information
Symbol
Dmel\CG7766-RB
Species
D. melanogaster
Annotation Symbol
CG7766-RB
FlyBase ID
FBtr0071352
Feature type
Associated gene
Evidence Rank
Length (nt)
4702
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 70 )
Sequence
GGTCACACTGTGTGACATTGAGTTGACTTTAGTTGCATTAGTTTAATTGCAATTTTATTCGATTTATTCGCAAATAAGTG
AGCAGCCCAACGTCGAAACTCGAACGGCAACGGTCCACACCGCCATCCGCCGCATCCCGGAGAGAATGCGCTGTCCTCGC
GGCGAATTCCACGGATTCAACGGCTTCTAGCGGCCGCGAGGTGTTCCGAGGAGCTCTGGGATTCTAGCACCACCTCCTCC
ACTCCGCCGAACCACAACAAACGATCCACAGCGATCCCAACCGATCTGATATTATAACTTACCGGCAAGGTATCCACATC
CACGATGCGTTCTCGCAGCAATTCGGGCGTCCGTTTGGACTACTATCAGCGCATTGTGCATCGTCTGATCCTGGCCCACC
AGGAACCGGTCACCGGTCTGTTTCCCGCCTCGAATGTGAACTCGCACGCCTGGATCAGGGACAATGTGTACTGCATCTTG
GCCGTTTGGGGCTTGTCCATGGCGTACAAGAAGATTGCCGATCAGGACGAGGATCGGGCCAAATGCTATGAGCTGGAGCA
GAGCTGTGTAAAGCTAATGCGTGGCCTGCTCATGGCCATGATGAACCAGAAGGACAAGGTAGAGAAGTTCAAGATGACCC
AGAGCCCGTACGATTCGCTGCACGCCAAGTATTCCAGCAAGAACGGCTTGCCCGTGGTCGATGACAATGAGTGGGGTCAT
CTGCAGATCGATGCCGTGTCCCTGTACCTGCTGATCCTGGCCCAGATGACGGCCTCCGGCCTGCAGATCGTCTTCTCCCT
GGACGAGGTGTCATTCATCCAGAATCTGGTCTTCTACATCGAGTCAGCGTACTCGATTCCCGACTATGGCATTTGGGAGC
GCGGCGATAAAACCAATCATGGTGAACCCGAGCTGAATGCCAGCTCCATTGGCATGGCCAAGGCGGCGCTGGAGGCCATG
AACGAGCTGGATCTGTTCGGAGCCCGTGGCGGTCCGGCTAGTGTCATCCATGTGCTGGCCGACGAGGCCCACAAATGCCA
GGCGGTGCTGCAGTCGATGCTGCCGCGCGAGTCGAATAGCAAGGAATTGGATTCCGGTCTGCTGTGCGTCATCGGCTTTC
CCGCCTTTGCTGTGGACGATGCCCAGCTGATACACAACACCAAGGATGCCATTCTATCCCGTCTGCAGGGCAAGTACGGC
TGCAAGAGATTCTTGCGCGATGGCTATCGCACACCGAAGGAGGATCCCTCGAGGCTATACTACGAGCGCTGGGAGCTGCG
CATGTTCGAGAACATCGAGTGCGAGTGGCCGCTATTCTACTGCTACCTAATCCTGTTCCACGCCTTCCAGAGCGACAAGC
GGGCGGTGGAGGAGTACGCCAGCCGTTTGGAGAAGATCATGGTGCGTTCGGAAGATGGCATTCTACTTGTTCCCGAGAGC
TATGCAGTGCCGCAGGATCTGGTGGGCTTCGAGTATCAGAAGCCGGGATCGCAGGTCCGCGAAGTGGTCGGCCGGTGTCC
GTTCCTCTGGGGCCAGTCCCTATTCATCCTCGGCAGATTGCTGCAGGAGGGTTTCCTGGCTGTGGGCGAATTGGATCCAT
TGAATCGTCGCCTGGGCGCTCAAAAGAAGCCGGACGTCGTCGTCCAAGTGGTCATCATTGCCGAGGACAACGAAATCCGC
GACAAGCTGGCCGAACACGATCTGCACGTGCAGACGATCGCAGAGGTGGCGCCCATTGAGGTGCAGCCCGCCCGAGTTCT
GAGTCATCTGTACACCTATTTGGGACGCAATCGGAAATTGGGTTTGAGCGGCAGAAAGTCACGTGATGTGGGCATCCTTA
GCACCAGTAAGCTTTACTCGCTTAAGGATCGCATATTTGCCTTCACGCCGCAGCATATCGACTATGAAGAATATTATACA
ACACGCGATCCCGATTTGCTTGCCAGCAATTTTACCACAAATTTAGCATTCTTGACCAACAATTGGCGTCACATGTTGGG
CAGGCCGACAATCACACTAATGGCAACCCACTATATGCTAGATCAGGACAAGATCCCGCTGGCCATGATCCAGACGATGA
GGAAACTCAAATCGGGCTACATCAATGGCACACGCGTAATGCTGGGCAGCCTGAAGGACTTTCTCAACACCTCGGCCATC
ACGGATCTGAGCTTTTTGGGCAGCACCGAGGATGGCTATCCGGACCGCCTGCATCCGGATGTGCAGACCTATTTGGATGA
GCATCTGCTGCGCTCGTTTAGCAATCGCAGCACCATGAATCTGCGCGGCGGACAATTGCGTCCGCGAACATTGAGGCGAC
GCATGTCCTGCAAGGGAGCCATCAAGAAGACGCGCTCCATCAACGTGGATTCTGATAACCTGGGCATGGAGGGACCTTCT
CCGCTGACGGAACGTCGCCTGTCCTCGATTGTCCCACCACCATGGCTGCAGGCCAACAAACAGAGCCACGTCAGTGTGTT
CGCCACGACGCCGGAGGAGGGACCCACCAGCTCGCCGCTGAGCCTGGGCAACGATCTAATCCGGGAGAATATCTATCCGG
TGGATCCGCACCACAGTCGCTCGGCGATCGACAGACGCAGCGAGTTTGTGCGCCAGCAAGAGATGCCAAAAATTCTAATA
CAACGCCATCGTGCCGAAACAAATTTCGCGGACACAGAAGTGGAGGAGCTGATTGCGATGCTGCGCGAAACGGAGAATCT
CGAGGAGCAGGGCGACATCCTACAGTACCTGGTGGACACACAGGGTCTGGACTTCAATACGGCCGGCCTGGGATTCAAGA
ATAAGTCGGAGGAGAATGCCACTCCGAATGCGAATAACGCCGGCATGCTCGAAGAGGGACGCGTGGTGACCGTGCGGGAT
CTGTTGAAGGGACTCTACGAGAAGGCATGCCAACAGAAGCTCTGGGGACTCGTCCGTCATACGGCCGGCATGCTGGGCAA
ACGTGTGGAGGATTTGGCCAAAGCGGTAACAGATCTGCTCGTCCGACAGAAGCAGGTCACCGTGGGAATGCCACCAAATA
ATGAGCACACCATTACGGCGCCGCTGCCGGAAGTCGAGCTGCGTCAGCTAATCCACGATGCCTATGGTGACGATGAGAGT
ACGGCGATGTTGACGCAGGAGTTGATGGTCTATCTGGCCATGTTCATACGCACCGAGCCGCAGCTGTTCCACGAGATGCT
ACGCCTGCGCGTCGGCCTGATCATCCAGGTAATGGCCAAGGAGCTGTCCCGCACCCTCAACTGCGACGGCGAGGCGGCGT
CGGAGCATTTACTTAACCTCTCGCCCTTCGAGATGAAAAATCTACTGTATCACATACTCAGCGGCAAGGAGTTTGCTGTT
AGTAGCGTCGCCCGTGGCAATCTGTCCATTGTGAGCTGCAAGAGCAGTCGCGTTAGCAAGAAGAGCCAAATCGGCCTGGG
TGATCCGGAGGGCGAAGACGCCCTCATAGCCACGATTGACGACCGCCAAGGTCAGTGGCTGCGCCGGCGACGTCTGGACG
GCGCCCTCAATCGTGTGCCCCGCGATTTCTATTCGCGCGTGTGGACCGTACTGGAGAAGTGCCAGGGTCTGGCCATCGAG
GGACGTGTCCTGCAGCAGAGTCTCACGCAAGAGATGACGCCGGGCGAACTGAAATTTGCGCTGGAGGTGGAGACGGCCCT
CAACCAGATACCGCAGCCCGAGTACAGGCAGCTGGTGGTCGAGGCTTTAATGGTGCTCACACTCGTTACCGAGCACAATA
TGGTGCCGTCGCTGGGTGGCGTCATCTACGTGGAGCATCTGGTGCACAAGGCCAATCAGTTGTTCCTCGAGGATCAGCGC
AAGGTGCAGGGCGATGCAACGCTGTGCTGCGCCAAGATTAAGGACGGCAAGGAGCAGCAGCAGGCCGCCTCCGGTATGCT
ACTCTGCGGCGGTGCCGCCTACATATGCCAGCATCTGTATGACAGTGCTCCCAGCGGCAGCTATGGTACCATGACCTATA
TGTCCCGGGCGGTGGCCCTTGTGCTCGACTGTGTGCCGAAGCACGGCGAGATGGAGTGCGCCATCTCCTAAACCGGTGGC
CATTCACCTAATCACTTAATTGTAATGCCAAAATCTCTGCAACACTGGATACGTCCGTTCTCGTTCTCGTTCCCGCTCGC
TCGCACACAGCTTAGCGCCCTCGCTCCGTCTCTCTCTACATCGATCGATCCTGCCTCTTTCTGATGTCTCTTTCTTTGTG
ACCTCTGACCCCCAAGCCCAACGATAATTTTAGTCAGCAGACGCATGTATATATTTTTTTTGACCACCCAAAAAAAAAAA
AAGCTTTGTTAACGTATTCGTTTTGTTTCGATTGAAAATGAAATGCAAGCCAATTTAAAATGGTATTAGCCCACATATGT
ACATTATGTATGTATGGATGTACGTATGTGTTGAGACCTTGGAAAGATACTCCAAAACTGCACCCAAAAAACCGATCCTA
ACCCCGCCACACCACCCAGCCAATCCATTTAGTAAGCCAACCCATGCTGCTCGGATACAGATTTGTTTTTTGTACTGGCA
GCTATTTTACAGCGACAACACTTTCGATTGTTTTAACTTTTGTATATTTAAAATGACCCTATTTTATATATTACTATTAT
ACGTTTGAATTGTAAAGTTGAACGCGCAGCAAGTTTTACAATAAAAATGTGTTTGCAATGTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0071351
4699
FBtr0114594
4873
FBtr0114595
4639
FBtr0309250
4972
FBtr0309251
5032
FBtr0343319
4588
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0071287
1248
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0071286
1247
FBpp0113086
1305
FBpp0113087
1227
FBpp0301189
1338
FBpp0301190
1358
FBpp0309977
1210
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG7766-RB
CG7766-RD
Secondary FlyBase IDs
    References (2)