Open Close
General Information
Symbol
Dmel\MFS16-RB
Species
D. melanogaster
Annotation Symbol
CG10069-RB
FlyBase ID
FBtr0071590
Feature type
Associated gene
Evidence Rank
Length (nt)
2399
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATAGTCGCGGGCAGCAGTCGATGTTTCTCCACCTTTATTTTGTTATTTTCCGACGGAGTAATGTTTACTGCAGCTGTTTA
        GTGTGTGTTTAACGGTAATATTAAGTGGCTAAAGCTGTTTTTCAATGTCGCCGTGTTTATTCCCAAGCAATCTGTTAGAT
        TCCGCAAGAAATTCCATCTGGTGGCGACAACAAACAAAGACTTAGAAATCCGACAAGCGTCGACTATGAAATACTCTGTA
        AATTGATGAGGACAAGTGAACAGAAAAGTAGCTGGCATTACTCGCAACCGAAACGGATTCGGGAACCCAGCCACCTGGAC
        GAGCAGCACTTGCACCTCGCCCACTGTCCGCGCCGGTCGATGAGAGCTTCACTGGGATTGGGCAGAACGCGAAAGATGAG
        CAATAACTACAACGACGTGCCATTCGGCATCCGGGCTGTGCAGCGGCTGTCCCGACAATGCTGCACCCGCTTCCATGCCC
        GCAGAGATTTGCTCTACAAGATGTCAGTGTTTGTGCTAACTTTCCTGGCCTACGCCTGCTATCACATGTGCCGCAAGCCC
        ATCTCCGTAGTCAAGTCGGTGCTGCAAGGAAACTGTTCCACAGCGCTGGCTGCATCGGGTCAGGATTGTGGATATGCGCC
        CTTTGATGTTCCCGATGCCACCACACTCTTTGGAATGCTGGACTCGGCCTTCCTCTTCTCCTATGCCATCGCTATGTTCG
        CTTCTGGTTTCGTGGCGGAACGCGTTTCCCTGCGATACTTCTTGTCCATGGGCATGATCCTCACCGGAGTGTTCACTTAC
        ATGTTCGGCATTGCTCGCACCTCCAATATCCATAGTTTGTGGTATTTCATAATAGTGCAAATATTCGCTGGCATCTTCCA
        GACGACCGGATGGCCAGGTGTAGTGGCCCTCGTGGGTCGTTGGTTTGGAAAGTCGAAACGCGGGCTCATTTTTGGTATAT
        GGAACAGTCATACGTCTATTGGAAACATTCTTGGCACGCTGATAGCGGCGCATTATGTGGAATCCGATTGGGCGCTGTCG
        TTTGTGGTACCCGGCATTATCATTGCAGCCGTTGGATTTTTACTCTTCCTTTTCCTAGTGGATCAGCCGGAGATTGTGGG
        CTGTTATCCACAAGCCGGACAGCATGAGCGTCGCGTGGCCAACGAGTCTGATGTGGAACAGGACGACGAGGAGCAGGTGC
        GCCATAACGATGCGGAAATCAACTATAGATCTGCTCCCACCGAACGTACTCCAATCCTTCCACGATCTCAACCAGAGGCG
        GTGCCAAGGGGTCGCGGACGTCCCATCAGTCTGATCGATGCTTTATTCATACCCGGTGTGGTAGAGTTTTCGCTGTGTTT
        GTTCTTTACCAAGCTGGTGAGCTACACCTTCATGTACTGGCTGCCACTTTACATACAAAAATCCAGCACATTGGGTCCAG
        AACTGTCCGCTGATTTGTCCACTCTTTTCGATGTGGGTGGTATTTTGGGTGCAATAGCTGCGGGCTATCTATCAGATGTG
        AGCGGAATGTCGGCCACCGTCTGCACAGGCATGTTGTTCGTTGCCTCGCCCATTCTGCTGATGTATCAACAATATGGTGC
        ATTGTCGATGACAATCAGCATAGTGCTCTTGATTGTGGTCGGCATCTTTGTGAACGGACCATATGCCCTGATTACAACCT
        CTGTAAGTGCAGAGCTGGGCCAGCACAGCTCCTTGGAGGGAAATGCCAATGCTCTGGCCACGGTGACGGCCATTATCGAT
        GGTACTGGGTCAATCGGAGCGGCAGTTGGTCCACTGCTTGCCGGCCTTATCTCCACCGCCGGATGGCAGTATGTCTTCCA
        CATGCTCATCGCTGCCGACATCATTGCCATGGTGCTGCTGGGGCGACTGGTCTTCAAGGAGTTCGCTGCACTGCGTCGTG
        CATCGCATCGTATTCGGATTGAATAGCAGGAAGAAGCTGAAGCGGATGTGGTTTGACCATATATATATTTTTGTTTCTAG
        CGTTCTCTGTACATACCATAGCATTTGTATAGCTAACATAAAGAACGTTTTCTTTTCATTCGAGAGCATATCAGAGTGTT
        TCTGATCCTAGTTTTACCCATACATGTCAATACCTAATGTTATTTTAAATGGAATGTTTACCATCATCTTAGGCTATCCA
        TCAAGTTTACAATTTTGATATATTACCTACATACATATATATATATATATATATATACATACATCTATGTTGTAATCTTG
        TGTGTGCGCGCGTGTGTCAGAGTCTCCTCGTTTTAAGTGCCGAACTATCATTAGTACTAGCGTAATTCTACTGCTATGTA
        AATACACTTTATCGTACACTTTTCGTACCAATAAAACCGAATTTGACTGTTCTCCGCGGCAGTACAATTTCTCAATGGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0071589
        2226
        FBtr0071591
        2563
        FBtr0342884
        2281
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0071516
        566
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0071515
        528
        FBpp0071517
        528
        FBpp0309685
        528
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG10069-RB
        MFS16-RB
        Secondary FlyBase IDs
          References (2)